Frequency of serological non-responders and false-negative RT-PCR results in SARS-CoV-2 testing: a population-based study

Objectives The sensitivity of molecular and serological methods for COVID-19 testing in an epidemiological setting is not well described. The aim of the study was to determine the frequency of negative RT-PCR results at first clinical presentation as well as negative serological results after a follow-up of at least 3 weeks. Methods Among all patients seen for suspected COVID-19 in Liechtenstein (n=1921), we included initially RT-PCR positive index patients (n=85) as well as initially RT-PCR negative (n=66) for follow-up with SARS-CoV-2 antibody testing.

Antibodies were detected with seven different commercially available immunoassays. Frequencies of negative RT-PCR and serology results in individuals with COVID-19 were determined and compared to those observed in a validation cohort of Swiss patients (n=211). Results Among COVID-19 patients in Liechtenstein, false-negative RT-PCR at initial presentation was seen in 18% (12/66), whereas negative serology in COVID-19 patients was 4% (3/85). The validation cohort showed similar frequencies: 2/66 (3%) for negative serology, and 16/155 (10%) for false negative RT-PCR. COVID-19 patients with negative follow-up serology tended to have a longer disease duration (p=0.05) and more clinical symptoms than other patients with COVID-19 (p<0.05).

The antibody titer from quantitative immunoassays was positively associated with the number of disease symptoms and disease duration (p<0.001). Conclusions RT-PCR at initial presentation in patients with suspected COVID-19 can miss infected patients. Antibody titers of SARS-CoV-2 assays are linked to the number of disease symptoms and the duration of disease. One in 25 patients with RT-PCR-positive COVID-19 does not develop antibodies detectable with frequently employed and commercially available immunoassays.

Polyclonal Goat Anti-GPR119 Antibody
APR16300G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GPR119 . This antibody is tested and proven to work in the following applications:
GPR119 antibody
70R-31399 100 ug
EUR 327
Description: Rabbit polyclonal GPR119 antibody
GPR119 Antibody
DF4892 200ul
EUR 304
Description: GPR119 Antibody detects endogenous levels of total GPR119.
GPR119 Antibody
1-CSB-PA007283
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR119. Recognizes GPR119 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000
GPR119 Antibody
ABD4892 100 ug
EUR 438
Gpr119/ Rat Gpr119 ELISA Kit
ELI-08203r 96 Tests
EUR 886
GPR119 Polyclonal Antibody
40973-100ul 100ul
EUR 252
GPR119 Polyclonal Antibody
40973-50ul 50ul
EUR 187
GPR119 Polyclonal Antibody
ABP53820-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
GPR119 Polyclonal Antibody
ABP53820-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
GPR119 Polyclonal Antibody
ABP53820-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
GPR119 Polyclonal Antibody
ES4819-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA
GPR119 Polyclonal Antibody
ES4819-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA
GPR119 siRNA
20-abx902267
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPR119 siRNA
20-abx918416
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPR119 siRNA
20-abx918417
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
GPR119 Polyclonal Conjugated Antibody
C40973 100ul
EUR 397
GPR119 Blocking Peptide
DF4892-BP 1mg
EUR 195
GPR119 Blocking Peptide
20-abx162463
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
GPR119 cloning plasmid
CSB-CL840575HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1008
  • Sequence: atggaatcatctttctcatttggagtgatccttgctgtcctggcctccctcatcattgctactaacacactagtggctgtggctgtgctgctgttgatccacaagaatgatggtgtcagtctctgcttcaccttgaatctggctgtggctgacaccttgattggtgtggccatct
  • Show more
Description: A cloning plasmid for the GPR119 gene.
GPR119 Rabbit pAb
A18544-100ul 100 ul
EUR 308
GPR119 Rabbit pAb
A18544-200ul 200 ul
EUR 459
GPR119 Rabbit pAb
A18544-20ul 20 ul
EUR 183
GPR119 Rabbit pAb
A18544-50ul 50 ul
EUR 223
Polyclonal GPR119 Antibody (aa186-235)
APR16477G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (aa186-235). This antibody is tested and proven to work in the following applications:
Polyclonal GPR119 Antibody (Cytoplasmic Domain)
APR16478G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
Polyclonal GPR119 Antibody (Cytoplasmic Domain)
APR16479G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280
Polyclonal Goat anti-GST p-form
GST-ANTI-3 50 uL
EUR 280
Mouse Gpr119 ELISA KIT
ELI-09750m 96 Tests
EUR 865
Rat GPR119 shRNA Plasmid
20-abx989158
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GPR119 shRNA Plasmid
20-abx965265
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse GPR119 shRNA Plasmid
20-abx982252
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human GPR119 ELISA KIT
ELI-48829h 96 Tests
EUR 824
GPR119 Recombinant Protein (Human)
RP039541 100 ug Ask for price
GPR119 Recombinant Protein (Rat)
RP203282 100 ug Ask for price
GPR119 Recombinant Protein (Mouse)
RP139418 100 ug Ask for price
G-Protein Coupled Receptor 119 (GPR119) Antibody
abx215630-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
G-Protein Coupled Receptor 119 (GPR119) Antibody
20-abx121407
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
G Protein-Coupled Receptor 119 (GPR119) Antibody
20-abx324143
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
G-Protein Coupled Receptor 119 (GPR119) Antibody
abx432763-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Gpr119 ORF Vector (Rat) (pORF)
ORF067762 1.0 ug DNA
EUR 506
GPR119 ORF Vector (Human) (pORF)
ORF013181 1.0 ug DNA
EUR 354
Gpr119 ORF Vector (Mouse) (pORF)
ORF046474 1.0 ug DNA
EUR 506
Gpr119 sgRNA CRISPR Lentivector set (Rat)
K7204201 3 x 1.0 ug
EUR 339
Gpr119 sgRNA CRISPR Lentivector set (Mouse)
K3605701 3 x 1.0 ug
EUR 339
GPR119 sgRNA CRISPR Lentivector set (Human)
K0895801 3 x 1.0 ug
EUR 339
Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7204202 1.0 ug DNA
EUR 154
Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7204203 1.0 ug DNA
EUR 154
Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7204204 1.0 ug DNA
EUR 154
Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3605702 1.0 ug DNA
EUR 154
Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3605703 1.0 ug DNA
EUR 154
Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3605704 1.0 ug DNA
EUR 154
GPR119 sgRNA CRISPR Lentivector (Human) (Target 1)
K0895802 1.0 ug DNA
EUR 154
GPR119 sgRNA CRISPR Lentivector (Human) (Target 2)
K0895803 1.0 ug DNA
EUR 154
GPR119 sgRNA CRISPR Lentivector (Human) (Target 3)
K0895804 1.0 ug DNA
EUR 154
GPR119 Protein Vector (Rat) (pPB-C-His)
PV271046 500 ng
EUR 603
GPR119 Protein Vector (Rat) (pPB-N-His)
PV271047 500 ng
EUR 603
GPR119 Protein Vector (Rat) (pPM-C-HA)
PV271048 500 ng
EUR 603
GPR119 Protein Vector (Rat) (pPM-C-His)
PV271049 500 ng
EUR 603
GPR119 Protein Vector (Mouse) (pPB-C-His)
PV185894 500 ng
EUR 603
GPR119 Protein Vector (Mouse) (pPB-N-His)
PV185895 500 ng
EUR 603
GPR119 Protein Vector (Mouse) (pPM-C-HA)
PV185896 500 ng
EUR 603
GPR119 Protein Vector (Mouse) (pPM-C-His)
PV185897 500 ng
EUR 603
GPR119 Protein Vector (Human) (pPB-C-His)
PV052721 500 ng
EUR 481
GPR119 Protein Vector (Human) (pPB-N-His)
PV052722 500 ng
EUR 481
GPR119 Protein Vector (Human) (pPM-C-HA)
PV052723 500 ng
EUR 481
GPR119 Protein Vector (Human) (pPM-C-His)
PV052724 500 ng
EUR 481
Gpr119 3'UTR Luciferase Stable Cell Line
TU108968 1.0 ml Ask for price
Gpr119 3'UTR Luciferase Stable Cell Line
TU205325 1.0 ml Ask for price
Gpr119 3'UTR GFP Stable Cell Line
TU158968 1.0 ml Ask for price
Gpr119 3'UTR GFP Stable Cell Line
TU255325 1.0 ml Ask for price
GPR119 3'UTR GFP Stable Cell Line
TU059210 1.0 ml
EUR 2333
GPR119 3'UTR Luciferase Stable Cell Line
TU009210 1.0 ml
EUR 2333
GPR119 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV629167 1.0 ug DNA
EUR 682
GPR119 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV629171 1.0 ug DNA
EUR 682
GPR119 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV629172 1.0 ug DNA
EUR 682
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7204205 3 x 1.0 ug
EUR 376
Gpr119 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3605705 3 x 1.0 ug
EUR 376

When should clinicians repeat SARS-CoV-2 RT-PCR?: Repeat PCR testing targeting patients with pulmonary CT findings suggestive of COVID-19

Real-time reverse transcription polymerase chain reaction (RT-PCR) testing for SARS-CoV-2 is sometimes repeated when clinicians suspect a false-negative result, but the conditions under which repeated RT-PCR testing is warranted remain unclear. We evaluated the practice of repeat RT-PCR testing for SARS-CoV-2 in 45 patients who retested after an initial negative PCR test. Of these, the diagnosis of coronavirus disease (COVID-19) was confirmed in four patients with typical chest computed tomography (CT) findings, and one patient without typical CT findings in whom the test result was strongly suspected to be false positive. We recommend repeat RT-PCR only for patients with typical CT findings of COVID-19.

A survey of gastrointestinal nematode species in red deer (Cervus elaphus) farms in New Zealand using PCR

Gastrointestinal nematodes are recognised as an animal health issue for farmed red deer. The aim of this study was to explore the range of species infecting farmed deer herds and their farm-level prevalence in New Zealand. Faecal samples were collected from 12-24-month-old deer (n = 6-26; mean 19) on 59 farms located in the North (n = 25) and South (n = 34) Islands. Sub-samples of faeces were pooled by farm and cultured to recover third stage larvae. Twenty four larvae were randomly selected and identified to species using a multiplex PCR (total = 1217 larvae). At farm-level the most prevalent nematodes were Oesophagostomum venulosum 83% (n = 49) and the deer-specific nematodes in the subfamily Ostertagiinae (=Ostertagia-type) including, Spiculoptera asymmetrica 73% (n = 43), Ostertagia leptospicularis 47% (n = 28), Spiculoptera spiculoptera 47% (n = 28). The recently identified Trichostrongylus askivali was present on 32% (n = 19) of the farms and Oesophagostomum sikae on 17% (n = 10). In the analysis of the total number of larvae identified, the proportion was in similar order, 45% (n = 548) were O. venulosum, 14% (n = 173) S. asymmetrica, 10% (n = 124) S. spiculoptera, 9% (n = 114) O. leptospicularis, T. askivali, 3% (n = 40) and only 2% were O. sikae (n = 20). This study is the first to show the farm-level prevalence of nematode species in deer in New Zealand and the first to use PCR as a diagnostic tool. It provides data consistent with cross-infection from sheep/cattle to deer, and provided tentative insights into the proportions of the main GIN species across the deer population including O. sikae and T. askivali which have only recently been identified in New Zealand.

Polyclonal ETO polyclonal antibody

APR00372G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ETO polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal EzH2 polyclonal antibody

APR00373G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EzH2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal BRD2 polyclonal antibody

APR00374G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal JMJD2c polyclonal antibody

APR00375G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JMJD2c polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal BMI1 polyclonal antibody

APR00376G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BMI1 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal SHH Polyclonal Antibody

APR00434G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SHH Polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal ETO polyclonal antibody

APR00435G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ETO polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal EZH2 polyclonal antibody

APR00436G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EZH2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal RARA polyclonal antibody

APR00437G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RARA polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal MYH11 polyclonal antibody

APR00438G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYH11 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal EZH2 polyclonal antibody

APR00439G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EZH2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal p53K372me1 polyclonal antibody

APR00440G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human p53K372me1 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal CIITA polyclonal antibody

APR00442G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CIITA polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal p53 polyclonal antibody

APR00443G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human p53 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal CHD4 polyclonal antibody

APR00444G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CHD4 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal HDAC1 polyclonal antibody

APR00445G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDAC1 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal Spt16 polyclonal antibody

APR00446G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Spt16 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal BRD2 polyclonal antibody

APR00447G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal G9a polyclonal antibody

APR00448G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human G9a polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal Hira polyclonal antibody

APR00449G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Hira polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal JMJD2c polyclonal antibody

APR00450G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JMJD2c polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal SPI1 polyclonal antibody

APR00451G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPI1 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal BCL7C polyclonal antibody

APR00452G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BCL7C polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal LRWD1 polyclonal antibody

APR00455G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LRWD1 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal LYDG10 polyclonal antibody

APR00456G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LYDG10 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal BMI1 polyclonal antibody

APR00457G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BMI1 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal KDM4D polyclonal antibody

APR00458G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KDM4D polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal CHD4 polyclonal antibody

APR00459G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CHD4 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal Spt16 polyclonal antibody

APR00460G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Spt16 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal ZMYND8 polyclonal antibody

AMM08559G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ZMYND8 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal PML polyclonal antibody

AMR09397G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PML polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal PPARG polyclonal antibody

AMR09459G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PPARG polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal PPARG polyclonal antibody

AMR09486G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PPARG polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal FKBP51 polyclonal antibody

APR15992G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FKBP51 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal PIWIL2 polyclonal antibody

APR17846G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PIWIL2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal AKR1B10 Polyclonal Antibody

APG01659G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AKR1B10 Polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal Rtf1 polyclonal antibody

APR11187G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rtf1 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal Rtf1 polyclonal antibody

APR11188G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Rtf1 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal JARID2 polyclonal antibody

APR12450G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JARID2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal Med26 polyclonal antibody

APR12517G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Med26 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal Med26 polyclonal antibody

APR12518G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Med26 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal MeCP2 polyclonal antibody

APR12525G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MeCP2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal MeCP2 polyclonal antibody

APR12526G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MeCP2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal MeCP2 polyclonal antibody

APR12527G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MeCP2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal SOX4 polyclonal antibody

APR13475G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SOX4 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal YY1 polyclonal antibody

APR14018G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human YY1 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal PADI4 polyclonal antibody

APR08916G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PADI4 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal ACTL6B polyclonal antibody

AMM05547G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ACTL6B polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal JARID2 polyclonal antibody

AMM06027G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JARID2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal MeCP2 polyclonal antibody

AMM06350G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MeCP2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal MeCP2 polyclonal antibody

AMM06351G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MeCP2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal AntibodyP5 Polyclonal Antibody

ES4829-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against P5 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Polyclonal AntibodyP5 Polyclonal Antibody

ES4829-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against P5 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Polyclonal AntibodyP3 Polyclonal Antibody

ES6454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against P3 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Polyclonal AntibodyP3 Polyclonal Antibody

ES6454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against P3 from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Polyclonal AntibodyP1 Polyclonal Antibody

ES11752-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against P1. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal AntibodyP1 Polyclonal Antibody

ES11752-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against P1. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal AntibodyP2 Polyclonal Antibody

ES10016-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against P2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal AntibodyP2 Polyclonal Antibody

ES10016-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against P2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal AntibodyP4 Polyclonal Antibody

ES10017-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against P4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal AntibodyP4 Polyclonal Antibody

ES10017-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against P4 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal TGF-beta3 Polyclonal Antibody

APG00008G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TGF-beta3 Polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal sRANK Ligand Polyclonal Antibody

APR00294G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human sRANK Ligand Polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal FGF-1 Polyclonal Antibody

APR00423G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FGF-1 Polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal RFX-AP polyclonal antibody

APR00441G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RFX-AP polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal EIF2C1/2 polyclonal antibody

APR00453G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EIF2C1/2 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal Smc3K112/113ac polyclonal antibody

APR00454G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Smc3K112/113ac polyclonal . This antibody is tested and proven to work in the following applications:

H2AFV Polyclonal Antibody

30191-100ul 100ul
EUR 252

H2AFV Polyclonal Antibody

30191-50ul 50ul
EUR 187

PGLYRP2 Polyclonal Antibody

30192-100ul 100ul
EUR 252

PGLYRP2 Polyclonal Antibody

30192-50ul 50ul
EUR 187

TUBGCP5 Polyclonal Antibody

30193-100ul 100ul
EUR 252

TUBGCP5 Polyclonal Antibody

30193-50ul 50ul
EUR 187

OSBPL8 Polyclonal Antibody

30194-100ul 100ul
EUR 252

OSBPL8 Polyclonal Antibody

30194-50ul 50ul
EUR 187

SFXN2 Polyclonal Antibody

30195-100ul 100ul
EUR 252

SFXN2 Polyclonal Antibody

30195-50ul 50ul
EUR 187

FOPNL Polyclonal Antibody

30196-100ul 100ul
EUR 252

FOPNL Polyclonal Antibody

30196-50ul 50ul
EUR 187

CNTD1 Polyclonal Antibody

30197-100ul 100ul
EUR 252

CNTD1 Polyclonal Antibody

30197-50ul 50ul
EUR 187

TBC1D16 Polyclonal Antibody

30198-100ul 100ul
EUR 252

TBC1D16 Polyclonal Antibody

30198-50ul 50ul
EUR 187

ASB17 Polyclonal Antibody

30199-100ul 100ul
EUR 252

ASB17 Polyclonal Antibody

30199-50ul 50ul
EUR 187

NUDT16 Polyclonal Antibody

30200-100ul 100ul
EUR 252

NUDT16 Polyclonal Antibody

30200-50ul 50ul
EUR 187

CLVS2 Polyclonal Antibody

30201-100ul 100ul
EUR 252

CLVS2 Polyclonal Antibody

30201-50ul 50ul
EUR 187

BCDIN3D Polyclonal Antibody

30202-100ul 100ul
EUR 252

BCDIN3D Polyclonal Antibody

30202-50ul 50ul
EUR 187

FBXL14 Polyclonal Antibody

30203-100ul 100ul
EUR 252